Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276721

Xenopus ORFeome
What is the ORFeome?

ORF Name:gata2.L ORF1 Species: laevis
Gene Symbol: gata2.L Entrez Gene ID: 399273
Gene Synonyms: gata-2, xgata-2, xgata2
Gene Name: GATA binding protein 2
Description: zinc finger transcription factor
Plate: GDExl11066 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834204
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis XGATA-2 protein, mRNA (cDNA clone MGC:131004 IMAGE:7978680), complete cds
Template Accession: BC108544
GI: 80476386
Clone ID: IMAGE:7978680
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb9
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGTGGCCACTGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCCATAGCCGTCACCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556