Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276745

Xenopus ORFeome
What is the ORFeome?

ORF Name:gata5.L ORF1 Species: laevis
Gene Symbol: gata5.L Entrez Gene ID: 379521
Gene Synonyms: gata-4a, gata-5, gata5-a, gata5-b, xgata-5, xgata-5a, xgata-5b, xgata5, xgata5a, xgata5b
Gene Name: GATA binding protein 5
Description: zinc finger transcription factor
Plate: GDExl11021 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824673
3' ORF Sequence: JZ830025
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor xGATA-5b, mRNA (cDNA clone MGC:68439 IMAGE:5571176), complete cds
Template Accession: BC055963
GI: 33416799
Clone ID: IMAGE:5571176
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACCCCAGCCTGGCCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAAGTGCCAGAGCGCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers