Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276781

Xenopus ORFeome
What is the ORFeome?

ORF Name:gba.L ORF1 Species: laevis
Gene Symbol: gba.L Entrez Gene ID: 447570
Gene Synonyms: gba1, gcb
Gene Name: glucosidase, beta, acid
Description:
Plate: GDExl11059 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832909
3' ORF Sequence: JZ832910
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84284 protein, mRNA (cDNA clone MGC:84284 IMAGE:6956726), complete cds
Template Accession: BC081165
GI: 51704046
Clone ID: IMAGE:6956726
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGTCCTGGTTCCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGATAAAATAGTTGGCCCAGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers