Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276817

Xenopus ORFeome
What is the ORFeome?

ORF Name:gbx2.1.L ORF1 Species: laevis
Gene Symbol: gbx2.1.S Entrez Gene ID: 399181
Gene Synonyms: xgbx-2
Gene Name: gastrulation brain homeobox 2, gene 1
Description: homeodomain transcription factor
Plate: GDExl11076 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836118
3' ORF Sequence: JZ836119
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeobox protein GBX-2b, mRNA (cDNA clone MGC:114973 IMAGE:4756878), complete cds
Template Accession: BC100215
GI: 71679801
Clone ID: IMAGE:4756878
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGCAGCCTTTCAGCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTCTTGTCTGCTCCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers