Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276901

Xenopus ORFeome
What is the ORFeome?

ORF Name:gdf1.S ORF1 Species: laevis
Gene Symbol: gdf1.L Entrez Gene ID: 677862
Gene Synonyms: dvr-1, dvr1, gdf-1, vg-1, vg1
Gene Name: growth differentiation factor 1
Description: tgf-beta related peptide growth factor
Plate: GDExl11080 Well: G10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836939
3' ORF Sequence: JZ836940
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC090232.1 Xenopus laevis transforming growth factor-beta Vg1 gene, mRNA (cDNA clone MGC:85164 IMAGE:6870372), complete cds
Template Accession: BC090232
GI: 58833396
Clone ID: IMAGE:6870372
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTGGCTGAGACTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGCAGCCACACTCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers