Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276931

Xenopus ORFeome
What is the ORFeome?

ORF Name:gemin2.S ORF1 Species: laevis
Gene Symbol: gemin2.S Entrez Gene ID: 494588
Gene Synonyms: sip1, sip1-delta, smn interacting protein 1
Gene Name: gem nuclear organelle associated protein 2
Description:
Plate: GDExl11052 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831893
3' ORF Sequence: JZ831894
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Survival of motor neuron protein-interacting protein 1, mRNA (cDNA clone MGC:83567 IMAGE:5079407), complete cds
Template Accession: BC077574
GI: 50416393
Clone ID: IMAGE:5079407
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAGGCTGTTACCGGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATGGGTCATTACAGTCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556