Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17277099

Xenopus ORFeome
What is the ORFeome?

ORF Name:mgc69466.L ORF1 Species: laevis
Gene Symbol: mgc69466.L Entrez Gene ID: 379171
Gene Synonyms: connexin40, cx40.4, xlcx40.4
Gene Name: MGC69466 protein
Description:
Plate: GDExl11012 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824015
3' ORF Sequence: JZ829323
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to gap junction membrane channel protein alpha 3, mRNA (cDNA clone MGC:53082 IMAGE:5542182), complete cds
Template Accession: BC043801
GI: 27696894
Clone ID: IMAGE:5542182
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGACTGGAACTTGCTGGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCGCAAGGACTCCCG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556