Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17277555

Xenopus ORFeome
What is the ORFeome?

ORF Name:gnl3l.S ORF1 Species: laevis
Gene Symbol: gnl3l.S Entrez Gene ID: 496093
Gene Synonyms:
Gene Name: guanine nucleotide binding protein-like 3 (nucleolar)-like
Description: GTPase
Plate: GDExl11084 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837376
3' ORF Sequence: JZ837375
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496093, mRNA (cDNA clone MGC:154605 IMAGE:8329596), complete cds
Template Accession: BC125997
GI: 117558431
Clone ID: IMAGE:8329596
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGGAACAAGCACAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCGCTCAGTGAAAAATTCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers