Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17277591

Xenopus ORFeome
What is the ORFeome?

ORF Name:golga2.S ORF1 Species: laevis
Gene Symbol: golga2.S Entrez Gene ID: 447440
Gene Synonyms: gm130
Gene Name: golgin A2
Description: Uncharacterized conserved protein
Plate: GDExl11045 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830610
3' ORF Sequence: JZ830611
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC81213 protein, mRNA (cDNA clone MGC:81213 IMAGE:6318691), complete cds
Template Accession: BC081001
GI: 51895933
Clone ID: IMAGE:6318691
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGACGGGAGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCACCATAATTCGGACCTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers