Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17277921

Xenopus ORFeome
What is the ORFeome?

ORF Name:gpx7.S ORF1 Species: laevis
Gene Symbol: gpx7.S Entrez Gene ID: 496254
Gene Synonyms:
Gene Name: glutathione peroxidase 7
Description: Glutathione peroxidase
Plate: GDExl11078 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836612
3' ORF Sequence: JZ836613
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496254, mRNA (cDNA clone MGC:85208 IMAGE:3377406), complete cds
Template Accession: BC088790
GI: 56789628
Clone ID: IMAGE:3377406
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACTTCGCGGCTCTCGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTCTTCTTTCTTCTTCAGAAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556