Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278047

Xenopus ORFeome
What is the ORFeome?

ORF Name:gsk3b.L ORF1 Species: laevis
Gene Symbol: gsk3b.L Entrez Gene ID: 399097
Gene Synonyms: gsk-3, gsk3, gsk3-beta, gsk3beta, xgsk-3
Gene Name: glycogen synthase kinase 3 beta
Description: serine/threonine kinase, wnt signal transduction
Plate: GDExl11086 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837998
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis intracellular kinase, mRNA (cDNA clone MGC:131076 IMAGE:7981621), complete cds
Template Accession: BC108581
GI: 80476466
Clone ID: IMAGE:7981621
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGGAAGGCCGAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGAGTTGGAGGCAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers