Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278359

Xenopus ORFeome

ORF Name:h1f0 ORF2 Species: laevis
Gene Symbol: h1f0.L Entrez Gene ID: 398662
Gene Synonyms: h10, h1f0-a, h1f0-b, h1fv, h1zero
Gene Name: H1 histone family member 0
Description: chromatin structure
Plate: GDExl11038 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827315
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis histone H1(0)-1, mRNA (cDNA clone MGC:80509 IMAGE:5156970), complete cds
Template Accession: BC072941
GI: 49257362
Clone ID: MGC:80509 IMAGE:5156970
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGAGAATTCCGCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTCCGTCCAGATTTCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556