Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278599

Xenopus ORFeome
What is the ORFeome?

ORF Name:hba1.L ORF1 Species: laevis
Gene Symbol: hba1.L Entrez Gene ID: 108702027
Gene Synonyms: alpha globin, alpha-globin, cd31, t3 globin
Gene Name: hemoglobin subunit alpha 1
Description: hemoglobin, oxygen transport
Plate: GDExl11041 Well: F05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827815
3' ORF Sequence: JZ827816
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:80675 IMAGE:5511109, complete cds
Template Accession: BC073294
GI: 49255995
Clone ID: IMAGE:5511109
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTCTTTCAGCCGATGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGATATTTGGATGTCAGAACAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers