Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278647

Xenopus ORFeome
What is the ORFeome?

ORF Name:hbg1.L ORF1 Species: laevis
Gene Symbol: hbg1.L Entrez Gene ID: 734881
Gene Synonyms: adult b major globin, beta-1-globin, beta-globin, hbb1, hbga, hbgr, hsggl1
Gene Name: hemoglobin subunit gamma 1
Description: Globins and related hemoproteins
Plate: GDExl11073 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835632
3' ORF Sequence: JZ835633
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC132374, mRNA (cDNA clone MGC:132374 IMAGE:3396440), complete cds
Template Accession: BC106693
GI: 77748192
Clone ID: IMAGE:3396440
Tissue: liver
Stage:
Clone Library: NICHD_XGC_Li1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTTGACAGCACATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTAACCCTTGCCAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556