Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278827

Xenopus ORFeome
What is the ORFeome?

ORF Name:herpud2.L ORF1 Species: laevis
Gene Symbol: herpud2.L Entrez Gene ID: 379247
Gene Synonyms:
Gene Name: HERPUD family member 2
Description: membrane-associated ER protein involved in stress response
Plate: GDExl11009 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823672
3' ORF Sequence: JZ828981
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC52715, mRNA (cDNA clone MGC:52715 IMAGE:4683712), complete cds
Template Accession: BC044318
GI: 27882450
Clone ID: IMAGE:4683712
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACATGCCAGCCTGTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGACACCTTGAGGAGGTCCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers