Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278839

Xenopus ORFeome
What is the ORFeome?

ORF Name:hes1.L ORF1 Species: laevis
Gene Symbol: hes1.L Entrez Gene ID: 397813
Gene Synonyms: hairy1, hes-1, hes1-a, hes1-b, xhairy1
Gene Name: hes family bHLH transcription factor 1
Description: helix-loop-helix transcription factor/transcriptional repressor
Plate: GDExl11024 Well: A04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825022
3' ORF Sequence: JZ830387
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hairy1, mRNA (cDNA clone MGC:78862 IMAGE:4030543), complete cds
Template Accession: BC070988
GI: 47507254
Clone ID: IMAGE:4030543
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGCTGATGTGATGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGGCCTCCAAACAGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers