Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17278845

Xenopus ORFeome
What is the ORFeome?

ORF Name:hes1.S ORF2 Species: laevis
Gene Symbol: hes1.S Entrez Gene ID: 379073
Gene Synonyms: hairy1, hes-1, hes1-a, hes1-b, xhairy1
Gene Name: hes family bHLH transcription factor 1
Description: helix-loop-helix transcription factor/transcriptional repressor
Plate: GDExl11086 Well: A03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837876
3' ORF Sequence: JZ837875
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hairy and enhancer of split 1, mRNA (cDNA clone MGC:160184 IMAGE:8526774), complete cds
Template Accession: BC128932
GI: 118835754
Clone ID: IMAGE:8526774
Tissue: whole organism
Stage: NF stage 56 to NF stage 62
Clone Library: NICHD_XGC_int_m
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGCTGATGTGATGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGGCCTCCAAACAGAGTCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556