Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279319

Xenopus ORFeome
What is the ORFeome?

ORF Name:hnrnpd.L ORF1 Species: laevis
Gene Symbol: hnrnpd.L Entrez Gene ID: 496375
Gene Synonyms: hnrpd, p37 auf1
Gene Name: heterogeneous nuclear ribonucleoprotein D
Description: mRNA processing
Plate: GDExl11082 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837070
3' ORF Sequence: JZ837069
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis p37 AUF1, mRNA (cDNA clone MGC:115607 IMAGE:3746201), complete cds
Template Accession: BC097855
GI: 66911596
Clone ID: IMAGE:3746201
Tissue: oocyte
Stage: NF stage 5 (16-cell) to NF stage 6 (32-cell)
Clone Library: Xenopus laevis oocyte non normalized
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCTACTACTGCTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATGGTTTGTAACTATTTTGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers