Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279427

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxa1.L ORF1 Species: laevis
Gene Symbol: hoxa1.L Entrez Gene ID: 373787
Gene Synonyms: bsas, hox1f, hoxa1-a, hoxa1-b, xhox.lab, xhox.lab2, xhoxa1
Gene Name: homeobox A1
Description: homeodomain transcription factor
Plate: GDExl11012 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823897
3' ORF Sequence: JZ829206
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeo box A1, mRNA (cDNA clone MGC:52991 IMAGE:5536792), complete cds
Template Accession: BC044984
GI: 27924328
Clone ID: IMAGE:5536792
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACTATGCGAGGAGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCGGAGGCACTGAGATGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers