Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279439

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxa2.S ORF1 Species: laevis
Gene Symbol: hoxa2.S Entrez Gene ID: 399169
Gene Synonyms: hox1k, hoxa2-a, hoxa2-b, hoxa2b, x-hoxa2
Gene Name: homeobox A2
Description: homeodomain transcription factor
Plate: GDExl11089 Well: G02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838281
3' ORF Sequence: JZ838280
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor Hoxa2, mRNA (cDNA clone MGC:154497 IMAGE:8318875), complete cds
Template Accession: BC123244
GI: 114108098
Clone ID: IMAGE:8318875
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTACGAATTTGAGCGAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGTTCAAATGGTGCAAGTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers