Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279493

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxc6.S ORF1 Species: laevis
Gene Symbol: hoxc6.S Entrez Gene ID: 394330
Gene Synonyms: aci, xeb1, xlhbox1
Gene Name: homeobox C6
Description: homeodomain transcription factor
Plate: GDExl11074 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835654
3' ORF Sequence: JZ835655
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeo box protein, mRNA (cDNA clone MGC:83468 IMAGE:4757374), complete cds
Template Accession: BC084319
GI: 54038054
Clone ID: IMAGE:4757374
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTCCTATTTCACTAACCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTTGCCTTGTCCCTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556