Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279523

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxd10.L ORF1 Species: laevis
Gene Symbol: hoxd10.L Entrez Gene ID: 399032
Gene Synonyms: hox-4.4, hox4, hox4d, hox4e, xhoxd10
Gene Name: homeobox D10
Description: homeodomain transcription factor
Plate: GDExl11022 Well: B08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824897
3' ORF Sequence: JZ830267
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeobox protein, Hoxd10, mRNA (cDNA clone MGC:68611 IMAGE:4032032), complete cds
Template Accession: BC061944
GI: 38541381
Clone ID: IMAGE:4032032
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTTTCCCAACAGCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAAAAAGTTAGATTCGCGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers