Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279547

Xenopus ORFeome
What is the ORFeome?

ORF Name:hpca.S ORF1 Species: laevis
Gene Symbol: hpca.S Entrez Gene ID: 446775
Gene Synonyms: mgc80408, mgc84992
Gene Name: hippocalcin
Description: Ca2+ sensor
Plate: GDExl11078 Well: A08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836487
3' ORF Sequence: JZ836488
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hippocalcin, mRNA (cDNA clone MGC:84992 IMAGE:6325343), complete cds
Template Accession: BC088916
GI: 57032987
Clone ID: IMAGE:6325343
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAACAATGAGAATGGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATTGAGAAGCTGTACTAGGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers