Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279733

Xenopus ORFeome
What is the ORFeome?

ORF Name:prmt5.S ORF1 Species: laevis
Gene Symbol: prmt5.S Entrez Gene ID: 407754
Gene Synonyms: hsl7
Gene Name: protein arginine methyltransferase 5
Description: protein kinase inhibitor
Plate: GDExl11025 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ830476
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis methyltransferase Hsl7, mRNA (cDNA clone MGC:81112 IMAGE:6317313), complete cds
Template Accession: BC068696
GI: 46250300
Clone ID: IMAGE:6317313
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGGTGACGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCAATTGTGTAAGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers