Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279739

Xenopus ORFeome
What is the ORFeome?

ORF Name:hsp70.L ORF1 Species: laevis
Gene Symbol: hsp70.L Entrez Gene ID: 398343
Gene Synonyms: xhsp70
Gene Name: heat shock 70kDa protein
Description: molecular chaperone
Plate: GDExl11053 Well: C08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828619
3' ORF Sequence: JZ828620
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis heat shock protein, mRNA (cDNA clone MGC:83630 IMAGE:5084801), complete cds
Template Accession: BC078115
GI: 50415516
Clone ID: IMAGE:5084801
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCAAAGGAGTCGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAACTTCTTCTATAGTTGGACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556