Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279769

Xenopus ORFeome
What is the ORFeome?

ORF Name:hspa1l.S ORF1 Species: laevis
Gene Symbol: hspa1l.S Entrez Gene ID: 379760
Gene Synonyms: hsp70
Gene Name: heat shock protein family A (Hsp70) member 1 like
Description: Molecular chaperones HSP70/HSC70, HSP70 superfamily
Plate: GDExl11007 Well: F08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823550
3' ORF Sequence: JZ828848
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Heat shock cognate protein 70, mRNA (cDNA clone MGC:52655 IMAGE:4681532), complete cds
Template Accession: BC041201
GI: 27371246
Clone ID: IMAGE:4681532
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGGGACCAGCAGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCAACCTCCTCAATAGTAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers