Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279895

Xenopus ORFeome
What is the ORFeome?

ORF Name:hvcn1.L ORF1 Species: laevis
Gene Symbol: hvcn1.L Entrez Gene ID: 496219
Gene Synonyms: hv1, vsop
Gene Name: hydrogen voltage gated channel 1
Description: Clathrin coat dissociation kinase GAK/PTEN/Auxilin and related tyrosine phosphatases
Plate: GDExl11061 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833226
3' ORF Sequence: JZ833227
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Voltage-gated hydrogen channel 1, mRNA (cDNA clone MGC:99143 IMAGE:7206009), complete cds
Template Accession: BC088681
GI: 56788928
Clone ID: IMAGE:7206009
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGTGCCTGCG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAGCAGGAAATACGTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556