Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279949

Xenopus ORFeome

ORF Name:icam5 ORF1 Species: laevis
Gene Symbol: icam5.L Entrez Gene ID: 494840
Gene Synonyms: telencephalin, tlcn, tln
Gene Name: intercellular adhesion molecule 5
Description: Immunoglobulin C-2 Type/fibronectin type III domains
Plate: GDExl11006 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ840221
3' ORF Sequence: JZ840220
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC494840, mRNA (cDNA clone MGC:161107 IMAGE:6873806), complete cds
Template Accession: BC133241
GI: 124481906
Clone ID: MGC:161107 IMAGE:6873806
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTACATGTGAAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATACACAATACATAAAAATTGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556