Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279967

Xenopus ORFeome

ORF Name:id3 ORF2 Species: laevis
Gene Symbol: id3.L Entrez Gene ID: 379222
Gene Synonyms: heir-1, id3-a, id3-b, xid3, xidia, xidx
Gene Name: inhibitor of DNA binding 3, HLH protein
Description: transcriptional regulator
Plate: GDExl11017 Well: C08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ824346
3' ORF Sequence: JZ829705
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to inhibitor of DNA binding 3, dominant negative helix-loop-helix protein, mRNA (cDNA clone MGC:52572 IMAGE:5572155), complete cds
Template Accession: BC044039
GI: 27696824
Clone ID: MGC:52572 IMAGE:5572155
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGCCATCAGCCCAGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCAGACGCTGGTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556