Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17279997

Xenopus ORFeome
What is the ORFeome?

ORF Name:idh3b.S ORF1 Species: laevis
Gene Symbol: idh3b.S Entrez Gene ID: 443821
Gene Synonyms:
Gene Name: isocitrate dehydrogenase (NAD(+)) 3 beta
Description: oxidoreductase
Plate: GDExl11030 Well: F03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825974
3' ORF Sequence: JZ825973
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC79028 protein, mRNA (cDNA clone MGC:79028 IMAGE:4408522), complete cds
Template Accession: BC072104
GI: 48735414
Clone ID: IMAGE:4408522
Tissue: heart
Stage:
Clone Library: NICHD_XGC_He1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGCTCAGACATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGAGGTTGGATATGACAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers