Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280105

Xenopus ORFeome
What is the ORFeome?

ORF Name:igf2bp3.S ORF1 Species: laevis
Gene Symbol: igf2bp3.S Entrez Gene ID: 379623
Gene Synonyms: b3, igf2bp3-a, igf2bp3-b, imp, imp3, vera, vg1 rbp, vg1-rbp, vg1rbp, vg1rbp, vickz3
Gene Name: insulin like growth factor 2 mRNA binding protein 3
Description: RNA-binding protein
Plate: GDExl11020 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824665
3' ORF Sequence: JZ830017
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis KH domain-containing transcription factor B3, mRNA (cDNA clone MGC:68429 IMAGE:6862521), complete cds
Template Accession: BC057700
GI: 35505482
Clone ID: IMAGE:6862521
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAAGCTGTATATTGGAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTCTTCTTGGTTGGGGTTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556