Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280243

Xenopus ORFeome
What is the ORFeome?

ORF Name:ilf2.L ORF1 Species: laevis
Gene Symbol: ilf2.L Entrez Gene ID: 380267
Gene Synonyms: nf45
Gene Name: interleukin enhancer binding factor 2
Description: transcription factor
Plate: GDExl11015 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824263
3' ORF Sequence: JZ829589
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis interleukin enhancer binding factor 2, 45kDa, mRNA (cDNA clone MGC:53292 IMAGE:5570304), complete cds
Template Accession: BC043981
GI: 27696435
Clone ID: IMAGE:5570304
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGGTGAACGAGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTGTGTCTCCATACTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers