Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280537

Xenopus ORFeome
What is the ORFeome?

ORF Name:irf2.L ORF1 Species: laevis
Gene Symbol: irf2.L Entrez Gene ID: 495990
Gene Synonyms: irf-2
Gene Name: interferon regulatory factor 2
Description: transcription factor
Plate: GDExl11061 Well: E07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833204
3' ORF Sequence: JZ833205
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495990, mRNA (cDNA clone MGC:99145 IMAGE:7206034), complete cds
Template Accession: BC087378
GI: 56269523
Clone ID: IMAGE:7206034
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGTAGAAAGGATGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATGTCTTGAGCCGCG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers