Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280639

Xenopus ORFeome
What is the ORFeome?

ORF Name:irx3.L ORF1 Species: laevis
Gene Symbol: irx3.L Entrez Gene ID: 399365
Gene Synonyms: irx3b, mgc131103, xiro-3, xiro3
Gene Name: iroquois homeobox 3
Description: homeodomain transcription factor
Plate: GDExl11086 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837979
3' ORF Sequence: JZ837978
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeobox transcription factor iriquois 3, mRNA (cDNA clone MGC:131103 IMAGE:7982631), complete cds
Template Accession: BC108595
GI: 80479310
Clone ID: IMAGE:7982631
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCCCACAGCTGGGCTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGAGGATAAAGCGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers