Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280657

Xenopus ORFeome
What is the ORFeome?

ORF Name:isl1.S ORF1 Species: laevis
Gene Symbol: isl1.S Entrez Gene ID: 100126604
Gene Synonyms: islet-1, islet1, xisl-1, xislet-1
Gene Name: ISL LIM homeobox 1
Description: homeodomain transcription factor
Plate: GDExl11092 Well: C03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838775
3' ORF Sequence: JZ838774
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis islet-1, mRNA (cDNA clone MGC:154537 IMAGE:8320777), complete cds
Template Accession: BC124894
GI: 115528274
Clone ID: IMAGE:8320777
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGATATGGGAGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCTCTATAGGGCTGGCTAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556