Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280675

Xenopus ORFeome
What is the ORFeome?

ORF Name:isy1.L ORF1 Species: laevis
Gene Symbol: isy1.L Entrez Gene ID: 443937
Gene Synonyms: fsap33
Gene Name: ISY1 splicing factor homolog
Description:
Plate: GDExl11035 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826810
3' ORF Sequence: JZ826811
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80278 protein, mRNA (cDNA clone MGC:80278 IMAGE:5073408), complete cds
Template Accession: BC072869
GI: 49117068
Clone ID: IMAGE:5073408
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGGAATGCAGAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGCCTAACAGTCGTTTTGCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers