Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280795

Xenopus ORFeome
What is the ORFeome?

ORF Name:itpa.S ORF1 Species: laevis
Gene Symbol: itpa.S Entrez Gene ID: 735008
Gene Synonyms:
Gene Name: inosine triphosphatase
Description: Inosine triphosphate pyrophosphatase
Plate: GDExl11064 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833787
3' ORF Sequence: JZ833788
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC131132, mRNA (cDNA clone MGC:131132 IMAGE:7206328), complete cds
Template Accession: BC110771
GI: 84569959
Clone ID: IMAGE:7206328
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGCAGCCGGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCTTCGTGCCATTCTGGAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers