Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280831

Xenopus ORFeome

ORF Name:jag1 ORF1 Species: laevis
Gene Symbol: jag1.L Entrez Gene ID: 399110
Gene Synonyms: jagged1, serrate, serrate-1, x-serrate-1
Gene Name: jagged 1
Description: signal transduction/notch signaling pathway
Plate: GDExl11074 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ835666
3' ORF Sequence: JZ835667
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis X-Serrate-1 protein, mRNA (cDNA clone MGC:83439 IMAGE:5085067), complete cds
Template Accession: BC084953
GI: 54648465
Clone ID: MGC:83439 IMAGE:5085067
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGTTTCCCAAGGAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTCTGCCACGGAAGCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556