Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280867

Xenopus ORFeome

ORF Name:jarid2 ORF2 Species: laevis
Gene Symbol: jarid2.L Entrez Gene ID: 495842
Gene Synonyms: jarid2-a, jarid2-b, jmj, jumonji
Gene Name: jumonji and AT-rich interaction domain containing 2
Description: DNA binding
Plate: GDExl11070 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ835137
3' ORF Sequence: JZ835138
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495842, mRNA (cDNA clone MGC:98789 IMAGE:3396392), complete cds
Template Accession: BC086634
GI: 55991536
Clone ID: MGC:98789 IMAGE:3396392
Tissue: liver
Stage: frog
Clone Library: NICHD_XGC_Li1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTGTACAGGAAAATGAGAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGAAGCACTTTTGGAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556