Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280909

Xenopus ORFeome
What is the ORFeome?

ORF Name:jun.S ORF1 Species: laevis
Gene Symbol: jun.S Entrez Gene ID: 379050
Gene Synonyms: ap-1, c-jun
Gene Name: jun proto-oncogene
Description: transcriptional activator
Plate: GDExl11008 Well: E11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823627
3' ORF Sequence: JZ828928
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis jun oncogene, mRNA (cDNA clone MGC:52542 IMAGE:4683930), complete cds
Template Accession: BC041183
GI: 27371021
Clone ID: IMAGE:4683930
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGCAAAGATGGAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAATGTTTGCATCTGCTGTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556