Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280957

Xenopus ORFeome
What is the ORFeome?

ORF Name:kank2.L ORF1 Species: laevis
Gene Symbol: kank2.L Entrez Gene ID: 380032
Gene Synonyms: ankrd25, mxra3
Gene Name: KN motif and ankyrin repeat domains 2
Description: Ankyrin repeat protein
Plate: GDExl11015 Well: B02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824264
3' ORF Sequence: JZ829590
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC53293, mRNA (cDNA clone MGC:53293 IMAGE:5570306), complete cds
Template Accession: BC049177
GI: 29165865
Clone ID: IMAGE:5570306
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCAAGTTCTTCATATGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGGATTCATCTGATGGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556