Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17280975

Xenopus ORFeome
What is the ORFeome?

ORF Name:kars.L ORF1 Species: laevis
Gene Symbol: kars1.L Entrez Gene ID: 380325
Gene Synonyms: kars, kars2, krs
Gene Name: lysyl-tRNA synthetase 1
Description: Lysyl-tRNA synthetase (class II)
Plate: GDExl11011 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823939
3' ORF Sequence: JZ829248
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis lysyl-tRNA synthetase, mRNA (cDNA clone MGC:52992 IMAGE:5536826), complete cds
Template Accession: BC047965
GI: 28838484
Clone ID: IMAGE:5536826
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGTACCAGCACTGCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGACGTCCCATCAGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556