Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281233

Xenopus ORFeome
What is the ORFeome?

ORF Name:keap1.L ORF1 Species: laevis
Gene Symbol: keap1.L Entrez Gene ID: 496326
Gene Synonyms: inrf2, klhl19
Gene Name: kelch like ECH associated protein 1
Description: Proteins containing BTB/POZ and Kelch domains, involved in regulatory/signal transduction processes
Plate: GDExl11078 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836512
3' ORF Sequence: JZ836513
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496326, mRNA (cDNA clone MGC:84985 IMAGE:6325151), complete cds
Template Accession: BC088917
GI: 57033127
Clone ID: IMAGE:6325151
Tissue: egg
Stage:
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGCGACGGAGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGGTGTGTGAGGAGAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556