Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281419

Xenopus ORFeome
What is the ORFeome?

ORF Name:kirrel2.L ORF1 Species: laevis
Gene Symbol: kirrel2.L Entrez Gene ID: 379648
Gene Synonyms: neph1
Gene Name: kirre like nephrin family adhesion molecule 2
Description: Immunoglobulin C-2 Type/fibronectin type III domains
Plate: GDExl11018 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824555
3' ORF Sequence: JZ829907
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68902, mRNA (cDNA clone MGC:68902 IMAGE:4888651), complete cds
Template Accession: BC057728
GI: 34784609
Clone ID: IMAGE:4888651
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATCTCTGGCTGTTAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATGGGTCTGCATCCGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556