Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281647

Xenopus ORFeome
What is the ORFeome?

ORF Name:kpna3.L ORF1 Species: laevis
Gene Symbol: kpna3.L Entrez Gene ID: 432069
Gene Synonyms: ipoa4, srp1, srp1gamma, srp4
Gene Name: karyopherin alpha 3 (importin alpha 4)
Description: Karyopherin (importin) alpha
Plate: GDExl11024 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825011
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC78841, mRNA (cDNA clone MGC:78841 IMAGE:3402787), complete cds
Template Accession: BC070983
GI: 47507490
Clone ID: IMAGE:3402787
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGAACGCCGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTTAAATTCCTTTGTTTGCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556