Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281749

Xenopus ORFeome
What is the ORFeome?

ORF Name:krt8.S ORF1 Species: laevis
Gene Symbol: krt8.1.S Entrez Gene ID: 380217
Gene Synonyms: ck1, keratin8, krt8, xck1
Gene Name: keratin 8, gene 1
Description: fibrous structural protein
Plate: GDExl11007 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823552
3' ORF Sequence: JZ828850
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis keratin 8, mRNA (cDNA clone MGC:53564 IMAGE:4681607), complete cds
Template Accession: BC044116
GI: 28278601
Clone ID: IMAGE:4681607
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGTCAGATCGACCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTTTTGAGAAAACATCTGAGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556