Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281815

Xenopus ORFeome

ORF Name:lamtor1 ORF1 Species: laevis
Gene Symbol: lamtor1.S Entrez Gene ID: 379890
Gene Synonyms: p27rf-rho, pdro, ragulator1
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Description:
Plate: GDExl11003 Well: D03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ839433
3' ORF Sequence: JZ839432
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis hypothetical protein MGC64437, mRNA (cDNA clone MGC:64437 IMAGE:6880258), complete cds
Template Accession: BC054238
GI: 32450607
Clone ID: MGC:64437 IMAGE:6880258
Tissue: whole organism
Stage: NF stage 53
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCTGTTGTTACAGCGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGATCCCAAACTGTACAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556