Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17281821

Xenopus ORFeome

ORF Name:lamtor2 ORF1 Species: laevis
Gene Symbol: lamtor2.L Entrez Gene ID: 494825
Gene Synonyms: endap, hspc003, lamtor2-a, lamtor2-b, mapbpip, mapksp1ap, p14, ragulator2, robld3
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Description: MP1 adaptor interacting protein P14
Plate: GDExl11005 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ839894
3' ORF Sequence: JZ839893
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Mitogen-activated protein-binding protein-interacting protein A, mRNA (cDNA clone MGC:85491 IMAGE:6939762), complete cds
Template Accession: BC082921
GI: 52430492
Clone ID: MGC:85491 IMAGE:6939762
Tissue: whole organism
Stage: NF stage 53
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCGGCCCAAAGCGCTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGACGACACCTGGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556