Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282523

Xenopus ORFeome
What is the ORFeome?

ORF Name:lrr1.L ORF1 Species: laevis
Gene Symbol: lrr1.L Entrez Gene ID: 432125
Gene Synonyms: 4-1bblrr, lrr-1, ppil5
Gene Name: leucine rich repeat protein 1
Description: cell signaling
Plate: GDExl11030 Well: H04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825976
3' ORF Sequence: JZ825975
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC82386, mRNA (cDNA clone MGC:82386 IMAGE:4406402), complete cds
Template Accession: BC072264
GI: 47940296
Clone ID: IMAGE:4406402
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTTACAGTGTGAGGTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAGTACAATTGTTTGAATGAAGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556