Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282757

Xenopus ORFeome
What is the ORFeome?

ORF Name:ltc4s.2.L ORF1 Species: laevis
Gene Symbol: ltc4s.2.L Entrez Gene ID: 495166
Gene Synonyms: ltc4 synthase
Gene Name: leukotriene C4 synthase, gene 2
Description:
Plate: GDExl11006 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839962
3' ORF Sequence: JZ839961
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis hypothetical LOC495166, mRNA (cDNA clone MGC:85400 IMAGE:6932451), complete cds
Template Accession: BC084377
GI: 54038091
Clone ID: IMAGE:6932451
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACATCACATAGTTCTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTATTTTCAAACCCAGATAATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556